Great Offer




Green Envelope

Exapateter 🔎

Exaptingter is a type of protein found in the body that helps regulate blood sugar levels, particularly during fasting or when there's a decrease in insulin production.

Phaeapate 🔎

Phaeapate is a type of protein found in the cell membrane, which plays crucial roles in maintaining homeostasis and regulating cellular functions. It is essential for many biological processes such as energy metabolism, signal transduction, and cell signaling.

Apate 🔎

Apate is a plant in the family Fabaceae, commonly known as the "green pea." It's also known for its use in various culinary applications including making soups, sauces, and jams. The root of the plant, called apiculata, is used to make savory dishes like lamb chops or stews, while the leaves are often eaten fresh as a vegetable.

Apatelopteryx 🔎

Apatelopteryx is a type of fish commonly found in freshwater habitats such as lakes and rivers, often named after its distinctive appearance and coloration. It belongs to the family Apalotyla, which includes several genera including the Apatellidae, including the Apatelopteryx species.

Rapatea 🔎

Rapatea is a type of plant that grows in arid or semi-arid regions, typically found on rocky slopes and hillsides. It has needle-like leaves and stems with deep root systems, which allow it to thrive in dry conditions. Its flowers are usually small and white, often used as ornamental plants for their beauty and fragrance.

Apatemon 🔎

A pateamon is a type of stone that was used by ancient humans in their daily life, primarily for tools and weapons. These stones were often found on the sides of the road or along waterways, representing protection against evil spirits. They were also frequently used in religious ceremonies as symbols of divine protection.

Rapateaceae 🔎

Rapateaceae is a family of flowering plants that includes roses, lilies, and other related species. These plants are known for their large, fragrant flowers, which can be attractive in gardens or as cut flowers. The family was first described by Carl Linnaeus in 1753, and it's important to note that not all members of this family are native to the United States.

Apatelantha 🔎

Apatelanthus is a genus of flowering plants in the family Apocynaceae, native to the tropical and subtropical regions of South America. These plants are known for their large, brightly colored flowers with intricate patterns and often feature colorful fruits called "apateles" or "cactus cherries."

Apatetris 🔎

A pateetus, also known as a pate, is a type of bird that has two wings and is primarily adapted for flight.

Xenapates 🔎

Xenapates are small, flatworms that live in freshwater and brackish water bodies. They have a long, slender body with a distinctive yellow or orange coloration and a pair of large eyes on each side of their head. Xenapates can also be found in saltwater environments where they feed on algae and other microorganisms.

Apatetorides 🔎

Apatetorides are a group of proteins that play an essential role in the regulation of gene expression and cell proliferation, often involved in various cellular processes such as cell division, differentiation, and cancer development. They are primarily encoded by the human ATGATACATATACTAGATTTAGTATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT

Apatelodinae 🔎

The term "Apatelodinae" is a family of birds that includes several species known for their striking black and white plumage, which is often referred to as the "black and white race". These birds are primarily found in the tropical rainforests of South America. They are characterized by their distinctive black and white stripes across their back, with the majority of them being black. Their wings are also a deep shade of black, while other feathers typically have white markings. Overall,

Zapatella 🔎

Zapatella is a type of plant found in Central America, commonly known for its unique shape and texture. It's often associated with the indigenous people who cultivate it, such as the Zapotec people. These plants are known for their distinctive shapes, including the zapatella, which have a flattened shape that can be used both as a tool and an ornament.

Apatetica 🔎

Apatetica is a type of bacterium that can be found in soil, water, and other natural environments. It has a unique ability to form colonies and grow rapidly, making it a significant concern for environmental health issues such as pollution and nutrient runoff.

Apatelodidae 🔎

The term "apatelodidae" refers to a group of birds that are known for their distinctive feathered structures, which are unique to them and often serve as indicators of their species. This classification helps distinguish between different types of birds within this family.

Australapatemon 🔎

Australapatemon is a type of insect that has two sets of wings, which are typically located on opposite sides of its body. These wings enable it to fly in the air and move through the air as if it were flying. They are an important part of many insects' flight abilities, including those found in Australia.

Apateticus 🔎

Apateticus is a type of plant that has no root, stem, leaves or flowers, but instead has a simple, hollow or tubular structure called an apical meristem that produces new cells to replace lost ones. This allows them to grow rapidly and survive in a variety of environments, such as deserts and forests, where water is scarce or limited resources are abundant.

Phrenapates 🔎

Phrenapates are individuals with a unique set of facial features that have been observed in various populations throughout history, including humans and primates. These features include prominent ears, large eyes (known as "pupils"), prominent nose, and distinctive jaw lines and creases. The exact origin of these features is not fully understood but suggests they may be related to a genetic or cognitive trait that has been observed in certain populations.

Diapatela 🔎

Diapatela is a genus of flowering plants in the family Fabaceae, native to South America. They are known for their brightly colored flowers and are commonly found in tropical regions.

Hapatesus 🔎

Hapatesus is a type of cephalopod with two arms, known for its unique ability to swim in water and breathe through a membrane called a mesothorax or "mouth".

Micrapate 🔎

Micrapate is a type of bacteria that produces large amounts of mucus during reproduction, often leading to the formation of colonies in soil or water bodies. The mucus can be toxic and potentially harmful if ingested by animals or humans.

Kapateira 🔎

Kapateira is a term in the Indonesian language, specifically used for the term "kata" (noun) that means a small child or infant.

Apatema 🔎

Apatema is a type of plant that grows in shallow soil, often found on rocks or in damp environments. It has large leaves with numerous stomata for photosynthesis and small spores that are dispersed by wind or insects.

banner

Local Time


Ecosystem Biomes

Ecosystems can be broadly categorized into various types based on their characteristics and the organisms they support. Here are some common types of ecosystems:

Terrestrial Biomes

Tundra Taiga Montane Grasslands and Shrublands Alpine Tundra Coniferous Forests Broadleaf and Mixed Forests Deciduous Forests Grasslands Savannas Shrublands Tropical Forest Rainforest Seasonal Forest Tropical Coniferous Forests Moist Broadleaf Forests Dry Broadleaf Forests Tropical Grasslands, Savannas, and Shrublands Mediterranean Forests, Woodlands, and Scrub Deserts and Xeric Shrublands Steppe Flooded Grasslands and Savannas Riparian Wetland Mangrove

Aquatic Biomes

Pond Littoral Intertidal Mangroves Kelp Forests Coral Reefs Neritic Zone Pelagic Zone Benthic Zone Hydrothermal Vents Cold Seeps Demersal Zone

Other Biomes

Endolithic Zone

Biogeographic Realms

Afrotropical Antarctic Australasian Holarctic Nearctic Palearctic Indomalayan Neotropical Oceanian Antarctic / Southern Ocean Arctic Central Indo-Pacific Eastern Indo-Pacific Temperate Australasia Temperate Northern Atlantic Temperate Northern Pacific Temperate South America Temperate Southern Africa Tropical Atlantic Tropical Eastern Pacific Western Indo-Pacific ocean river lake pond stream swamp marsh

World Map

Registan-North Pakistan Sandy Desert Simpson Desert Siberian Steppe South Saharan Steppe and Woodlands Middle Arctic Tundra / Antarctic Desert Arabian Desert / Amsterdam Grassland Desert Tundra Tundra / Taiga Taiga Maputaland-Pondoland Bush and Thickets Montane Forests Cordillera Central Paramo Alpine Shrub Afghan Semi-Desert Parana Flooded Savanna Cuban / Enriquillo Wetlands / Guayaquil Arctic Foothills Tundra Arctic Tundra / Saharan Flooded Grassland Canadian Shield Taiga / Orinoco Delta Low Tundra / Montane Birch / Andean Puna Coastal Tundra / Flooded Savanna Cuban Pine / Pantanos / Valdivian Forest Sundarbans Swamp / Zambezi Savannah Belizian Pine Forests NE Siberian Taiga / New England-Acadian Forest Coastal / Lowland / Alpine Forests


Search Results
Abditibacteriota
Acidobacteriota, phenotypically diverse and mostly uncultured
Actinomycetota, High-G+C Gram positive species
Aquificota, deep-branching
Armatimonadota
Atribacterota
Bacillota, Low-G+C Gram positive species, such as the spore-formers Bacilli (aerobic) and Clostridia (anaerobic)
Bacteroidota
Balneolota
Bdellovibrionota
Caldisericota, formerly candidate division OP5, Caldisericum exile is the sole representative
Calditrichota
Campylobacterota
Chlamydiota
Chlorobiota, green sulphur bacteria
Chloroflexota, green non-sulphur bacteria
Chrysiogenota, only 3 genera (Chrysiogenes arsenatis, Desulfurispira natronophila, Desulfurispirillum alkaliphilum)
Coprothermobacterota
Deferribacterota
Deinococcota, Deinococcus radiodurans and Thermus aquaticus are "commonly known" species of this phyla
Dictyoglomota
Elusimicrobiota, formerly candidate division Thermite Group 1
Fibrobacterota
Fusobacteriota
Gemmatimonadota
Ignavibacteriota
Kiritimatiellota
Lentisphaerota, formerly clade VadinBE97
Mycoplasmatota, notable genus: Mycoplasma
Myxococcota
Nitrospinota
Nitrospirota
Planctomycetota
Pseudomonadota, the most well-known phylum, containing species such as Escherichia coli or Pseudomonas aeruginosa
Rhodothermota
Spirochaetota, species include Borrelia burgdorferi, which causes Lyme disease
Synergistota
Thermodesulfobacteriota
Thermomicrobiota
Thermotogota, deep-branching
Verrucomicrobiota

Ecosystem Species

Various species inhabit these ecosystems, each playing a unique role in maintaining the ecological balance.

Animals

Porifera (Sponges) Cnidaria (Jellyfish, Corals) Platyhelminthes (Flatworms) Nematoda (Roundworms) Annelida (Segmented Worms) Mollusca (Snails, Squids) Arthropoda (Insects, Crustaceans) Echinodermata (Sea Stars, Urchins) Jawless Fish (Agnatha) Cartilaginous Fish (Chondrichthyes) Bony Fish (Osteichthyes) Amphibians Reptiles Birds Mammals

Plants

Bryophyta (Mosses) Marchantiophyta (Liverworts) Anthocerotophyta (Hornworts) Lycophyta (Club Mosses) Pteridophyta (Ferns) Coniferophyta (Conifers) Cycadophyta (Cycads) Ginkgophyta (Ginkgo) Gnetophyta (Gnetum, Ephedra) Magnoliophyta (Flowering Plants)

Fungi

Chytridiomycota (Chytrids) Zygomycota (Bread Molds) Glomeromycota (Mycorrhizal Fungi) Ascomycota (Sac Fungi) Basidiomycota (Club Fungi)

Protists

Amoebozoa (Amoebas, Slime Molds) Excavata (Euglena, Giardia) Chromalveolata (Diatoms, Dinoflagellates) Rhizaria (Radiolarians, Forams) Archaeplastida (Red & Green Algae)

Bacteria

Proteobacteria Firmicutes Actinobacteria Cyanobacteria (Blue-Green Algae) Bacteroidetes Spirochaetes Chlamydiae Planctomycetes

Archaea

Euryarchaeota (Methanogens, Halophiles) Crenarchaeota (Thermophiles) Nanoarchaeota Korarchaeota fish bird insect mammal reptile amphibian mollusk fungi

Exapateter 🔎

Exaptingter is a type of protein found in the body that helps regulate blood sugar levels, particularly during fasting or when there's a decrease in insulin production.

Phaeapate 🔎

Phaeapate is a type of protein found in the cell membrane, which plays crucial roles in maintaining homeostasis and regulating cellular functions. It is essential for many biological processes such as energy metabolism, signal transduction, and cell signaling.

Apate 🔎

Apate is a plant in the family Fabaceae, commonly known as the "green pea." It's also known for its use in various culinary applications including making soups, sauces, and jams. The root of the plant, called apiculata, is used to make savory dishes like lamb chops or stews, while the leaves are often eaten fresh as a vegetable.

Apatelopteryx 🔎

Apatelopteryx is a type of fish commonly found in freshwater habitats such as lakes and rivers, often named after its distinctive appearance and coloration. It belongs to the family Apalotyla, which includes several genera including the Apatellidae, including the Apatelopteryx species.

Rapatea 🔎

Rapatea is a type of plant that grows in arid or semi-arid regions, typically found on rocky slopes and hillsides. It has needle-like leaves and stems with deep root systems, which allow it to thrive in dry conditions. Its flowers are usually small and white, often used as ornamental plants for their beauty and fragrance.

Apatemon 🔎

A pateamon is a type of stone that was used by ancient humans in their daily life, primarily for tools and weapons. These stones were often found on the sides of the road or along waterways, representing protection against evil spirits. They were also frequently used in religious ceremonies as symbols of divine protection.

Rapateaceae 🔎

Rapateaceae is a family of flowering plants that includes roses, lilies, and other related species. These plants are known for their large, fragrant flowers, which can be attractive in gardens or as cut flowers. The family was first described by Carl Linnaeus in 1753, and it's important to note that not all members of this family are native to the United States.

Apatelantha 🔎

Apatelanthus is a genus of flowering plants in the family Apocynaceae, native to the tropical and subtropical regions of South America. These plants are known for their large, brightly colored flowers with intricate patterns and often feature colorful fruits called "apateles" or "cactus cherries."

Apatetris 🔎

A pateetus, also known as a pate, is a type of bird that has two wings and is primarily adapted for flight.

Xenapates 🔎

Xenapates are small, flatworms that live in freshwater and brackish water bodies. They have a long, slender body with a distinctive yellow or orange coloration and a pair of large eyes on each side of their head. Xenapates can also be found in saltwater environments where they feed on algae and other microorganisms.

Apatetorides 🔎

Apatetorides are a group of proteins that play an essential role in the regulation of gene expression and cell proliferation, often involved in various cellular processes such as cell division, differentiation, and cancer development. They are primarily encoded by the human ATGATACATATACTAGATTTAGTATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT

Apatelodinae 🔎

The term "Apatelodinae" is a family of birds that includes several species known for their striking black and white plumage, which is often referred to as the "black and white race". These birds are primarily found in the tropical rainforests of South America. They are characterized by their distinctive black and white stripes across their back, with the majority of them being black. Their wings are also a deep shade of black, while other feathers typically have white markings. Overall,

Zapatella 🔎

Zapatella is a type of plant found in Central America, commonly known for its unique shape and texture. It's often associated with the indigenous people who cultivate it, such as the Zapotec people. These plants are known for their distinctive shapes, including the zapatella, which have a flattened shape that can be used both as a tool and an ornament.

Apatetica 🔎

Apatetica is a type of bacterium that can be found in soil, water, and other natural environments. It has a unique ability to form colonies and grow rapidly, making it a significant concern for environmental health issues such as pollution and nutrient runoff.

Apatelodidae 🔎

The term "apatelodidae" refers to a group of birds that are known for their distinctive feathered structures, which are unique to them and often serve as indicators of their species. This classification helps distinguish between different types of birds within this family.

Australapatemon 🔎

Australapatemon is a type of insect that has two sets of wings, which are typically located on opposite sides of its body. These wings enable it to fly in the air and move through the air as if it were flying. They are an important part of many insects' flight abilities, including those found in Australia.

Apateticus 🔎

Apateticus is a type of plant that has no root, stem, leaves or flowers, but instead has a simple, hollow or tubular structure called an apical meristem that produces new cells to replace lost ones. This allows them to grow rapidly and survive in a variety of environments, such as deserts and forests, where water is scarce or limited resources are abundant.

Phrenapates 🔎

Phrenapates are individuals with a unique set of facial features that have been observed in various populations throughout history, including humans and primates. These features include prominent ears, large eyes (known as "pupils"), prominent nose, and distinctive jaw lines and creases. The exact origin of these features is not fully understood but suggests they may be related to a genetic or cognitive trait that has been observed in certain populations.

Diapatela 🔎

Diapatela is a genus of flowering plants in the family Fabaceae, native to South America. They are known for their brightly colored flowers and are commonly found in tropical regions.

Hapatesus 🔎

Hapatesus is a type of cephalopod with two arms, known for its unique ability to swim in water and breathe through a membrane called a mesothorax or "mouth".

Micrapate 🔎

Micrapate is a type of bacteria that produces large amounts of mucus during reproduction, often leading to the formation of colonies in soil or water bodies. The mucus can be toxic and potentially harmful if ingested by animals or humans.

Kapateira 🔎

Kapateira is a term in the Indonesian language, specifically used for the term "kata" (noun) that means a small child or infant.

Apatema 🔎

Apatema is a type of plant that grows in shallow soil, often found on rocks or in damp environments. It has large leaves with numerous stomata for photosynthesis and small spores that are dispersed by wind or insects.

Deciduous Forest 🔎